Blepharisma_nuclear_code
Blepharisma nuclear code
An alternative genetic code found in the nuclear genome of some heterotrich ciliates
The Blepharisma nuclear code (translation table 15) is a genetic code found in the nuclei of Blepharisma.[1]
AAs = FFLLSSSSYY*QCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
| DNA codons | RNA codons | This code (15) | Standard code (1) | |
|---|---|---|---|---|
TAG | UAG | Gln (Q) | STOP = Ter (*) |
Ciliata: Blepharisma[2]
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- Andrzej Elzanowski; Jim Ostell (26 September 1996). "The Genetic Codes". National Center for Biotechnology Information. Archived from the original on 14 March 2016. Retrieved 20 January 2017.
- A Liang, K Heckman (1993). "Blepharisma uses UAA as a termination codon". Naturwissenschaften. 80 (5): 225–226. Bibcode:1993NW.....80..225L. doi:10.1007/bf01175738. PMID 7685500. S2CID 6219316.
- Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 3 July 2016.